Promega Corporation

pUC/M13 Sequencing Primers

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors. The primers are purified by gel electrophoresis or HPLC.

Primer Sequences

  • Forward (17mer): 5´-d(GTTTTCCCAGTCACGAC)-3´
  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

Expand to Read More »

  • Share
  • Print
  • Email
  • Prices valid for customers of Promega Korea Ltd only
Product Size Conc. Catalog # *List Price Order QTY Add to Cart

pUC/M13 Primer, Forward (17mer)

Close Window

pUC/M13 Primer, Forward (17mer)


  • pUC/M13 Primer, Forward (17mer)

    Q539A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.

Click here to learn more about the Helix Collection »

Already a Helix Customer?

Request to add this product to your Helix »

10μg/ml Q5391 ₩ 138,000 Add to cart

pUC/M13 Primer, Reverse (17mer)

Close Window

pUC/M13 Primer, Reverse (17mer)


  • pUC/M13 Primer, Reverse (17mer)

    Q540A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.

Click here to learn more about the Helix Collection »

Already a Helix Customer?

Request to add this product to your Helix »

10μg/ml Q5401 ₩ 138,000 Add to cart

pUC/M13 Primer, Reverse (22mer)

Close Window

pUC/M13 Primer, Reverse (22mer)


  • pUC/M13 Primer, Reverse (22mer)

    Q542A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.

Click here to learn more about the Helix Collection »

Already a Helix Customer?

Request to add this product to your Helix »

10μg/ml Q5421 ₩ 138,000 Add to cart

pUC/M13 Primer, Forward (24mer)

Close Window

pUC/M13 Primer, Forward (24mer)


  • pUC/M13 Primer, Forward (24mer)

    Q560A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.

Click here to learn more about the Helix Collection »

Already a Helix Customer?

Request to add this product to your Helix »

10μg/ml Q5601 ₩ 138,000 Add to cart

Storage Conditions

Store at –20°C. The primers are supplied in sterile water.

For product intended use please see Patents & Disclaimers tab.

Use Restrictions

Q5391, Q5401, Q5421, Q5601 For Research Use Only. Not for Use in Diagnostic Procedures.

Prefer a different language?

Your country is set to Korea, Republic Of. Your language is set to 한국어. Please select the language that will best suit your needs:

This is correct, continue to site »

I need additional help

It appears that you have Javascript disabled. Our website requires Javascript to function correctly. For the best browsing experience, please enable Javascript.